SimpleSearch - Line and FST details


Line specific information

 
Line ID 505H03
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair 12161
Parent of pair(s) none

Gene hit FCAALL

 
Sequence (A. th genome BLAST matches underlined)
>24-K019718-022-505-H03-8409
CTAATCATGTGCTTACTTTGACAGAGTTCTTCAAGAATTCTTTTCAACGAGAATCATTCA
GATCAAATGTAAGTTGTAAGTTATAATATGTGTTTTTTTTTACGAAGCTGACTACTAGGG
TATGGTCCCCTCCCT
GenBank Accession BX534007 [GenBank]
Graphic View Graphic view of sequence BX534007 of line 505H03
Predicted Position of Insertion Chr4:8525885 - go to primer design
BLAST e Value 2e-27
Hit Clone Code (BAC ID) FCAALL
Insertion Classification Genome Hit
Confirmation Status unknown
Other FSTs Supporting this Hit BX534006 [GenBank]


Last Updated on 10.06.2021 13:37