SimpleSearch - Line and FST details


Line specific information

 
Line ID 528D03
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) 6844

Gene hit At3g42770

 
Sequence (A. th genome BLAST matches underlined) 
>20-K020334-022-528-D03-8409
TGAATTACTCCATCTTAACTCAATCAAATTCAATTAAATTGAAAAAGCGTGAAGACCCCN
NNNNNGNTTTCGAGTTTGATTGNATGGTAAAGATTAAATTTTTATCTTTGTAAA
GenBank Accession BX536507 [GenBank]
Graphic View Graphic view of gene At3g42770
Predicted Position of Insertion Chr3:14866867 - go to primer design
BLAST e Value 2e-07
Hit Clone Code (BAC ID) F7P3
Hit Gene Code At3g42770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box/RNI-like/FBD-like domains-containing protein
Insertion Classification 5' region
Confirmation Status unknown


Last Updated on 10.06.2021 13:37