SimpleSearch - Line and FST details


Line specific information

 
Line ID 537H02
Vector Used pAC161
Line Availability available as T3 set from NASC (N451542)
Segregation Analysis 50:48:39
Confirmed for Hit At4g00040
Parent of DUPLO pair none
Parent of pair(s) 54879, 90532

Gene hit At4g00040

 
Sequence (A. th genome BLAST matches underlined) 
>16-K020491-022-537-H02-8409
CCCGGACAGAACCATTTACAATCGAATATATCCTGAAATGCTATGGGCATCCTCCCTATA
ATGAGCAGTGTTTGTGTGTCTTGGTGATGTTAGGCAAAAGCACAACTGTCAAGACACGCT
ACACAGTCATGTCACGGGAGACGCTGCACAAATACCCTGAGCTATGGGATCCTCCCTATA
GTGAGA
GenBank Accession BX547147 [GenBank]
Graphic View Graphic view of gene At4g00040
Predicted Position of Insertion Chr4:14869 - go to primer design
BLAST e Value 1e-45
Hit Clone Code (BAC ID) F6N15
Hit Gene Code At4g00040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chalcone and stilbene synthase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX547148 [GenBank] BX547147 [GenBank]


Last Updated on 10.06.2021 13:37