SimpleSearch - Line and FST details


Line specific information

 
Line ID 541B11
Vector Used pAC161
Line Availability available as T3 set from NASC (N451863)
Segregation Analysis 50:35:27
Confirmed for Hit At3g22460
Parent of DUPLO pair none
Parent of pair(s) 73953, 73963, 73964, 73965, 73967

Gene hit At3g22460

 
Sequence (A. th genome BLAST matches underlined) 
>82-K023956-022-541-B11-8409
TTTTATTCCAGGAATTATGGATGTAGATCCTATAAATGAAGTTGTTCCAGTAAAGTTTCA
TACCAATATCGTCCTGCTGACCCCAAAACCCACCTTACATTTCTTACTTGACTCTTATAG
TTTTGGAAAGCTTACGCAGGTTTCGGGGGGGGGATCCCTTGACATGGCAAGGCCT
GenBank Accession BX891333 [GenBank]
Graphic View Graphic view of gene At3g22460
Predicted Position of Insertion Chr3:7965106 - go to primer design
BLAST e Value 8e-38
Hit Clone Code (BAC ID) F16J14
Hit Gene Code At3g22460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-acetylserine (thiol) lyase (OAS-TL) isoform A2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX891333 [GenBank]


Last Updated on 10.06.2021 13:37