SimpleSearch - Line and FST details
Line specific information
| Line ID | 549C05 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N452637) |
| Segregation Analysis | 50:39:25 |
| Confirmed for Hit | At3g13724 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | none |
Gene hit At3g13724
| Sequence (A. th genome BLAST matches underlined) | >35-K020633-022-549-C05-8409 TAATGAGTATATCACCATTTAGTCCTATGGGATCCTCCCTATAGTGAG |
| GenBank Accession | FR812045 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr3:4496874 - go to primer design |
| BLAST e Value | 8e-04 |
| Hit Clone Code (BAC ID) | MMM17 |
| Hit Gene Code | At3g13724 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | miRNA |
| Insertion Classification | TS2TE |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | FR812045 [GenBank] |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
