SimpleSearch - Line and FST details


Line specific information

 
Line ID 562A02
Vector Used pAC161
Line Availability available as T3 set from NASC (N453858)
Segregation Analysis 50:45:35
Confirmed for Hit At1g47885
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g47885

 
Sequence (A. th genome BLAST matches underlined) 
>09-K021664-022-562-A02-8409
ATGCCCACTATATTTGTGATAGGCTAATGTCTTGGGACGATTCTGAAGACATCTCTTCTT
CAAAGTCTCCAATTGCTGATGAATTGAGCCGGGGAGATTGTTGTCTAATACATCCCTGGG
ATCCTCCCTATAGTGAGACCTATTACTCGGGGGTTTCCACCTAATTGTGACCCCACTAAA
ATCGCAGCTATATA
GenBank Accession BX651606 [GenBank]
Graphic View Graphic view of gene At1g47885
Predicted Position of Insertion Chr1:17642410 - go to primer design
BLAST e Value 2e-10
Hit Clone Code (BAC ID) T2E6
Hit Gene Code At1g47885 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribonuclease inhibitor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX651606 [GenBank]


Last Updated on 10.06.2021 13:37