SimpleSearch - Line and FST details


Line specific information

 
Line ID 571A11
Vector Used pAC161
Line Availability available as T3 set from NASC (N454731)
Segregation Analysis 50:37:26
Confirmed for Hit At5g52790
Parent of DUPLO pair none
Parent of pair(s) 6830

Gene hit At5g52790

 
Sequence (A. th genome BLAST matches underlined) 
>81-K023195-022-571-A11-8409
TCTGCGTCTCAATTCTTTACCATTTATTTGTTCATGTTTTGTTTTTCGTTGCCCAATGGG
ATCCTCCCCTATAGTGAGCACAACACAAATAAGTATCCAAATATATATGCAATAAGCTTG
ATACCTCCATTGCCAAAGCATTGCCTATAAGGAGATGGGACCCTCCCAATAGTGGGATAG
GGGGG
GenBank Accession BX891863 [GenBank]
Graphic View Graphic view of gene At5g52790
Predicted Position of Insertion Chr5:21393872 - go to primer design
BLAST e Value 1e-36
Hit Clone Code (BAC ID) F6N7
Hit Gene Code At5g52790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CBS domain protein with a domain protein (DUF21)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37