SimpleSearch - Line and FST details


Line specific information

 
Line ID 627C09
Vector Used pAC161
Line Availability available as T3 set from NASC (N460129)
Segregation Analysis 50:42:37
Confirmed for Hit At5g59780
Parent of DUPLO pair none
Parent of pair(s) 6800

Gene hit At5g59780

 
Sequence (A. th genome BLAST matches underlined)
>67-K023268-022-627-C09-8409
ATATAGTGAGGACACTGGAGGCTCCAACGGGAAAATGAATCAAGAATGCGAAGACGGGTA
CTACTCCATGGATGACATATGGAGACAGATTCCTCAGTCTG
GenBank Accession BX892649 [GenBank]
Graphic View Graphic view of gene At5g59780
Predicted Position of Insertion Chr5:24082788 - go to primer design
BLAST e Value 4e-37
Hit Clone Code (BAC ID) MTH12
Hit Gene Code At5g59780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 59
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX892648 [GenBank] BX892648 [GenBank]


Last Updated on 10.06.2021 13:37