SimpleSearch - Line and FST details


Line specific information

 
Line ID 629C11
Vector Used pAC161
Line Availability available as T3 set from NASC (N460323)
Segregation Analysis 50:32:23
Confirmed for Hit At5g07990
Parent of DUPLO pair none
Parent of pair(s) none
Note

Gene hit At5g07990

Sequence (A. th genome BLAST matches underlined)
>83-K113866-0022-629-C11-8409
TGCGCATATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTTCTTTTTCTCCA
TATTGACCATCATACTCATTGCTGATCCATGTAGATTGACCATCATATTCTCATTTTCTA
ACGCTATAACTCACTGGCCTGTAATCATGTCATTTCAATGTTTTGACTTTTTCTTTATAT
ATACATAATTATAATTTATAATTGGTGAGGGATTACACAACCTCTCACTATT
GenBank Accession HE664841 [GenBank]
Graphic View Graphic view of gene At5g07990
Predicted Position of Insertion Chr5:2560683 - go to primer design
BLAST e Value 6e-47
Hit Clone Code (BAC ID) F13G24
Hit Gene Code At5g07990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cytochrome P450 superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details