SimpleSearch - Line and FST details


Line specific information

 
Line ID 634G07
Vector Used pAC161
Line Availability available as T3 set from NASC (N460847)
Segregation Analysis 50:40:33
Confirmed for Hit At3g62380
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g62380

 
Sequence (A. th genome BLAST matches underlined) 
>55-K022834-022-634-G07-8409
AGCCATTTACATTGAATAATACATCAAGATTACTTTGTATGTTCCTGTAACCATGTCTCT
TCCAAATCCCACATTAATTGGCAAATCATTCGACCAACCTAAAGAAAAAAAAATAGACAT
TAAAGTACTATAACAACTATGGGACCCTCCCTATAGGGAGCCGTATTACTCACGG
GenBank Accession BX658377 [GenBank]
Graphic View Graphic view of gene At3g62380
Predicted Position of Insertion Chr3:23084160 - go to primer design
BLAST e Value 1e-46
Hit Clone Code (BAC ID) T12C14
Hit Gene Code At3g62380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box/associated interaction domain protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX658376 [GenBank]


Last Updated on 10.06.2021 13:37