SimpleSearch - Line and FST details


Line specific information

 
Line ID 649H03
Vector Used pAC161
Line Availability available as T3 set from NASC (N462295)
Segregation Analysis 50:48:40
Confirmed for Hit At5g11730
Parent of DUPLO pair none
Parent of pair(s) 93865, 93871, 93872, 93873, 93880, 93881, 93882

Gene hit At5g11730

 
Sequence (A. th genome BLAST matches underlined) 
>24-K023273-022-649-H03-8409
TTCTGTAGGCCTGTTTGCTATGTGCTCCATAATTACTTCCCCCCAAGGGCGCCCATTGAG
AAACCAACCGTCTTGGCTAACCGGAGCTTGACATGGGAGGACTGGACCAGGAGGGGTCCC
CAACCAG
GenBank Accession BX893708 [GenBank]
Graphic View Graphic view of gene At5g11730
Predicted Position of Insertion Chr5:3782167 - go to primer design
BLAST e Value 7e-17
Hit Clone Code (BAC ID) T22P22
Hit Gene Code At5g11730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX660021 [GenBank] BX893708 [GenBank]


Last Updated on 10.06.2021 13:37