SimpleSearch - Line and FST details


Line specific information

 
Line ID 652G06
Vector Used pAC161
Line Availability available as T3 set from NASC (N462574)
Segregation Analysis 50:50:49
Confirmed for Hit At5g61640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g61640

 
Sequence (A. th genome BLAST matches underlined) 
>47-K023205-022-652-G06-8409
CATTTGATCTGTCATATTGTGTTCTGCATCATTCTTATCGGCATTTAAACGTCCCCGCAA
ACGCTAATTTTATACCATGGTCCAATTTGGTCAATATGTTCCGCTGTATCGGCCCATCCT
TCCTCTTGCCACTTTCCTCTGTTTCTCTG
GenBank Accession FR814144 [GenBank]
Graphic View Graphic view of gene At5g61640
Predicted Position of Insertion Chr5:24774961 - go to primer design
BLAST e Value 0.016
Hit Clone Code (BAC ID) K11J9
Hit Gene Code At5g61640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation peptidemethionine sulfoxide reductase 1
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR814144 [GenBank]


Last Updated on 10.06.2021 13:37