SimpleSearch - Line and FST details


Line specific information

 
Line ID 653F03
Vector Used pAC161
Line Availability available as T3 set from NASC (N462655)
Segregation Analysis 50:27:20
Confirmed for Hit At1g66460
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g66460

 
Sequence (A. th genome BLAST matches underlined)
>22-K022839-022-653-F03-8409
ATTGAAAAGAACTTCCCTATATTTAGAATTGATGTATTGAGAAACGTCCATTTATAGGAA
AAGGGGCTTGTGGAGTATAAGTGCTACAACTACCAAAAGTCAAATAGGTTGGATTACTAT
GAAACCCTC
GenBank Accession BX660370 [GenBank]
Graphic View Graphic view of gene At1g66460
Predicted Position of Insertion Chr1:24790388 - go to primer design
BLAST e Value 2e-41
Hit Clone Code (BAC ID) F28G11
Hit Gene Code At1g66460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37