SimpleSearch - Line and FST details


Line specific information

 
Line ID 671C04
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) 94096

Gene hit At1g24530

 
Sequence (A. th genome BLAST matches underlined) 
>27-K022989-022-671-C04-8409
CCATTTACATTGAATATATCCGGACATGAAGCCATCATAAATTGGATCAGCTGATCGGAC
GGTCAGGATTTGGCGACGTGGACCCGCATTCTAGTTATAGTTGTTTGGAGGTTCTTTCCG
GTCATACCAAGCCGGTTAAGTCGTTGGCGGCGGTTACAGAAAAGGAGTTATACGATGTCC
ATTCGATCATTATTGGAAGTCCTGACA
GenBank Accession BX661133 [GenBank]
Graphic View Graphic view of gene At1g24530
Predicted Position of Insertion Chr1:8694306 - go to primer design
BLAST e Value 9e-69
Hit Clone Code (BAC ID) F21J9
Hit Gene Code At1g24530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit BX661133 [GenBank]


Last Updated on 10.06.2021 13:37