SimpleSearch - Line and FST details


Line specific information

 
Line ID 684G11
Vector Used pAC161
Line Availability available as T3 set from NASC (N465651)
Segregation Analysis 50:49:33
Confirmed for Hit At1g13170
Parent of DUPLO pair none
Parent of pair(s) 1604, 3574, 92247, 92249

Gene hit At1g13170

 
Sequence (A. th genome BLAST matches underlined) 
>87-K023047-022-684-G11-8409
CTCCCAATGAAATGAACTTCCCTTATATAGAGGAAGCGGCCAATGCCGAGAAACTGAGAC
TTGAACAGTTACAGAGACAGGTACCAAATCTATGGGAGA
GenBank Accession BX662094 [GenBank]
Graphic View Graphic view of gene At1g13170
Predicted Position of Insertion Chr1:4489235 - go to primer design
BLAST e Value 7e-20
Hit Clone Code (BAC ID) F3F19
Hit Gene Code At1g13170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation OSBP(oxysterol binding protein)-related protein 1D
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX662094 [GenBank]


Last Updated on 10.06.2021 13:37