SimpleSearch - Line and FST details


Line specific information

 
Line ID 691D11
Vector Used pAC161
Line Availability available as T3 set from NASC (N466287)
Segregation Analysis 50:12:6
Confirmed for Hit At3g46930
Parent of DUPLO pair 2567
Parent of pair(s) none

Gene hit At3g46930

 
Sequence (A. th genome BLAST matches underlined)
>84-K024535-022-691-D11-8409
ATTGAATATATCCTGTCCATTATATGAATCCGAATATATGAATCCCGAATTTAGGACATT
TCTTTAGTTCTGGACAGATCTGACTATGGGATCCTCCCTATAGTGAGTCGNATTACTCCC
GGC
GenBank Accession BX943684 [GenBank]
Graphic View Graphic view of gene At3g46930
Predicted Position of Insertion Chr3:17287966 - go to primer design
BLAST e Value 2e-20
Hit Clone Code (BAC ID) T6H20
Hit Gene Code At3g46930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX943684 [GenBank]


Last Updated on 10.06.2021 13:37