SimpleSearch - Line and FST details


Line specific information

 
Line ID 708A02
Vector Used pGABI1
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) 12736

Gene hit At4g11750

 
Sequence (A. th genome BLAST matches underlined)
>09-K023060-022-708-A02-8409
GCCTTTCAGCGCAATCTCAGCACACCAAATCATTCTTCTTCTGAGGGCCTCCACCACCCA
CATTTCTTCTCCCACAAAACCACAACCGTTTCCACTATAACCCAACAGTCTAACACAAGT
ATGGGATCCTCCCTATAGTGAG
GenBank Accession BX662700 [GenBank]
Graphic View Graphic view of gene At4g11750
Predicted Position of Insertion Chr4:7077499 - go to primer design
BLAST e Value 2e-41
Hit Clone Code (BAC ID) T5C23
Hit Gene Code At4g11750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactose oxidase/kelch repeat superfamily protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 10.06.2021 13:37