SimpleSearch - Line and FST details


Line specific information

 
Line ID 723H05
Vector Used pGABI1
Line Availability available as T3 set from NASC (N469401)
Segregation Analysis 50:49:42
Confirmed for Hit At1g51990
Parent of DUPLO pair none
Parent of pair(s) 5147

Gene hit At1g51990

 
Sequence (A. th genome BLAST matches underlined)
>40-K025364-022-723-H05-8409
CCTTTACATTGAATATAATTAGCCTATTATACCATACACCTCCCTTGGCTTTTGTATGGG
ATCCTCCCTATAGTGAGA
GenBank Accession CR358002 [GenBank]
Graphic View Graphic view of gene At1g51990
Predicted Position of Insertion Chr1:19331365 - go to primer design
BLAST e Value 1e-08
Hit Clone Code (BAC ID) F5F19
Hit Gene Code At1g51990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-methyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37