SimpleSearch - Line and FST details


Line specific information

 
Line ID 732F07
Vector Used pGABI1
Line Availability available as T3 set from NASC (N470243)
Segregation Analysis 50:46:32
Confirmed for Hit At3g09260
Parent of DUPLO pair none
Parent of pair(s) 6255, 6264, 7773, 10573, 10579, 70045, 70199, 70202, 70210, 70215, 70216, 70221

Gene hit At3g09260

 
Sequence (A. th genome BLAST matches underlined) 
>54-K025421-022-732-F07-8409
NNNNCCGACAGAAATCCGGACAGAACCATTTACAATTGAATAATCCTGAAACCATGGGAG
TGTAAGTTTGTTTTGCCCTTACTTGAAACCGAACCAAGAAAACCAATGGCAACAAATCAA
AGGGAAAATGTTTGTTTTTGGTATGGGATCCTCCCTATAGTGAGNNNNNNNNNNNNNNNN
NNNNNNNNNN
GenBank Accession CR358975 [GenBank]
Graphic View Graphic view of gene At3g09260
Predicted Position of Insertion Chr3:2841482 - go to primer design
BLAST e Value 2e-44
Hit Clone Code (BAC ID) F3L24
Hit Gene Code At3g09260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glycosyl hydrolase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR358976 [GenBank]


Last Updated on 10.06.2021 13:37