SimpleSearch - Line and FST details


Line specific information

 
Line ID 792G08
Vector Used pAC161
Line Availability available as T3 set from NASC (N476016)
Segregation Analysis 50:50:38
Confirmed for Hit At1g47128
Parent of DUPLO pair none
Parent of pair(s) 3378, 3680, 7140

Gene hit At1g47128

 
Sequence (A. th genome BLAST matches underlined) 
>63-K024948-022-792-G08-8409
AGCCATTTACATTGAATATATCTACATGAAGCCATCATACTCATTGCAAGACAAAACTCA
ATAAATGAAATTAATAGTACTAATAATTTAACAAATCATCATGTGTATAGGTCATTAGTC
ATTACTTAATTAGAGACGTTGACTTATAGTCTATGGGATCCTCCCTATAGTGAGACNTAT
TANTCN
GenBank Accession BX948752 [GenBank]
Graphic View Graphic view of gene At1g47128
Predicted Position of Insertion Chr1:17285010 - go to primer design
BLAST e Value 2e-54
Hit Clone Code (BAC ID) F2G19
Hit Gene Code At1g47128 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Granulin repeat cysteine protease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37