SimpleSearch - Line and FST details


Line specific information

 
Line ID 799A06
Vector Used pAC161
Line Availability available as T3 set from NASC (N476614)
Segregation Analysis 50:47:44
Confirmed for Hit At1g72700
Parent of DUPLO pair none
Parent of pair(s) 5452, 5533, 5546, 5716, 8698, 10371, 10413, 83079

Gene hit At1g72700

 
Sequence (A. th genome BLAST matches underlined) 
>41-K024952-022-799-A06-8409
TTGAATATATCCATGATAAAAGTAAAGATTTATTGTACATCTATGGGATCCTCCCTATAG
TGAGACGTATTACTCCCCCCGTTTCCCCGGGTTGGTTCCCCCCCGGCTTCTGCGCTTTTG
CGTCCCCTCTGTTGCTTTTGTNTGGGGCCTGCCTCTTTGGGGTTTT
GenBank Accession BX949470 [GenBank]
Graphic View Graphic view of gene At1g72700
Predicted Position of Insertion Chr1:27368978 - go to primer design
BLAST e Value 4e-06
Hit Clone Code (BAC ID) F28P22
Hit Gene Code At1g72700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX949470 [GenBank]


Last Updated on 10.06.2021 13:37