SimpleSearch - Line and FST details


Line specific information

 
Line ID 802C01
Vector Used pAC106
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) 9492

Gene hit At5g45070

 
Sequence (A. th genome BLAST matches underlined) 
>03-K023413-022-802-C01-8409
ACCATTTACAATTGAATAGAAAAAAGGTTGATCTCTTATCTTTTGCTCTCTTTTATTCAA
GAGTGAAAATCTATACTAACCTCTGTTCCCTACATAGATACATCTATGGGATCCTCCCTA
TAGTGAGTCNNATTACTCACC
GenBank Accession BX949698 [GenBank]
Graphic View Graphic view of gene At5g45070
Predicted Position of Insertion Chr5:18188892 - go to primer design
BLAST e Value 2e-26
Hit Clone Code (BAC ID) K21C13
Hit Gene Code At5g45070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phloem protein 2-A8
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit BX949698 [GenBank]


Last Updated on 10.06.2021 13:37