SimpleSearch - Line and FST details


Line specific information

 
Line ID 802D06
Vector Used pAC106
Line Availability available as T3 set from NASC (N476938)
Segregation Analysis 50:17:12
Confirmed for Hit At4g30560
Parent of DUPLO pair none
Parent of pair(s) 6281, 6297, 6329, 6348, 8855, 81609, 81617, 81626, 81630, 81635, 81641

Gene hit At4g30560

 
Sequence (A. th genome BLAST matches underlined) 
>44-K023413-022-802-D06-8409
CATTTACATTGAAGATAGCAGCCCAAGTTCTCCATTGTTGCGAGTAGAATCTGAATGTGT
GTTGAACTTGCCTGCTGTGTAGTCTTCTGAACTGGCTATGGGATCCTCCCTATA
GenBank Accession BX949706 [GenBank]
Graphic View Graphic view of gene At4g30560
Predicted Position of Insertion Chr4:14927210 - go to primer design
BLAST e Value 4e-43
Hit Clone Code (BAC ID) F17I23
Hit Gene Code At4g30560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cyclic nucleotide gated channel 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37