SimpleSearch - Line and FST details


Line specific information

 
Line ID 803A10
Vector Used pAC106
Line Availability available as T3 set from NASC (N477002)
Segregation Analysis 50:8:6
Confirmed for Hit At3g49430
Parent of DUPLO pair none
Parent of pair(s) 3499, 3510, 3561

Gene hit At3g49430

 
Sequence (A. th genome BLAST matches underlined) 
>73-K023416-022-803-A10-8409
AGCCATTTACATTGCCCTGAATTGGTAAAAGCAACATGTCACAATAATCACAGGAGAAAT
AAAAGAACGAATAAAAGTATCATGATGGTTGAGAGAAAGAACACAAAAGAAGGGCAGAAG
ACTTGCCTGGGGGGACTCTTCTTCTTGTCGGGCGATGGCGATCTATGGGATCCTCCCTAT
AGTGAGTCGTATTACTCN
GenBank Accession BX949771 [GenBank]
Graphic View Graphic view of gene At3g49430
Predicted Position of Insertion Chr3:18334657 - go to primer design
BLAST e Value 2e-79
Hit Clone Code (BAC ID) T9C5
Hit Gene Code At3g49430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SER/ARG-rich protein 34A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX949770 [GenBank]


Last Updated on 10.06.2021 13:37