SimpleSearch - Line and FST details


Line specific information

 
Line ID 830A02
Vector Used pAC106
Line Availability available as T3 set from NASC (N479586)
Segregation Analysis 50:32:6
Confirmed for Hit At3g04840
Parent of DUPLO pair none
Parent of pair(s) 1719

Gene hit At3g04840

 
Sequence (A. th genome BLAST matches underlined) 
>09-K025706-022-830-A02-8409
ATTGAAGATCAAAACTCTGTGTTTCAAGCCTTCTGAGGCAATCTGGAAGAGTAAGAACAG
ACATCATCATCAGTCTCAAAGTCCGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR400013 [GenBank]
Graphic View Graphic view of gene At3g04840
Predicted Position of Insertion Chr3:1330415 - go to primer design
BLAST e Value 5e-36
Hit Clone Code (BAC ID) T9J14
Hit Gene Code At3g04840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein S3Ae
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR400014 [GenBank]


Last Updated on 10.06.2021 13:37