SimpleSearch - Line and FST details


Line specific information

 
Line ID 834B05
Vector Used pAC106
Line Availability available as T3 set from NASC (N479985)
Segregation Analysis 50:32:16
Confirmed for Hit At1g48840
Parent of DUPLO pair 11864
Parent of pair(s) none

Gene hit At1g48840

 
Sequence (A. th genome BLAST matches underlined) 
>34-K025504-022-834-B05-8409
GNAGCCATTTACATTGAATATATCCTGAATATAGTGCATTTAACAATACTAAATTCAATC
AACCAAATAGAGAGGAGAATTTTCACACTTTGCTTGTGCAGAGAAAAACATACCTGGCCA
TGTAGATATTCCAATATGTTCAAGAACTGGTTGGGTAGTAACTGTATGGGATCCTCCCTA
TAGTGAG
GenBank Accession CR361314 [GenBank]
Graphic View Graphic view of gene At1g48840
Predicted Position of Insertion Chr1:18063062 - go to primer design
BLAST e Value 8e-69
Hit Clone Code (BAC ID) T24P22
Hit Gene Code At1g48840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heat-inducible transcription repressor (DUF639)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR361314 [GenBank]


Last Updated on 10.06.2021 13:37