SimpleSearch - Line and FST details


Line specific information

 
Line ID 835C06
Vector Used pAC106
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) 89419

Gene hit At2g33205

 
Sequence (A. th genome BLAST matches underlined)
>43-K025700-022-835-C06-8409
ATGNTCTTGTCCGTGTAGCTTCCGCTGATCCATTCATTGCCAAAACCTACAAGAAACTGA
AATTAAAGAACCTGTAAGTACGGGATCCTCCCTATAGTGAG
GenBank Accession CR400378 [GenBank]
Graphic View Graphic view of gene At2g33205
Predicted Position of Insertion Chr2:14073175 - go to primer design
BLAST e Value 1e-36
Hit Clone Code (BAC ID) F25I18
Hit Gene Code At2g33205 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Serinc-domain containing serine and sphingolipid biosynthesis protein
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit CR400378 [GenBank]


Last Updated on 10.06.2021 13:37