SimpleSearch - Line and FST details


Line specific information

 
Line ID 841E09
Vector Used pAC106
Line Availability available as T3 set from NASC (N480697)
Segregation Analysis 50:41:36
Confirmed for Hit At5g51060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g51060

 
Sequence (A. th genome BLAST matches underlined)
>69-K025724-022-841-E09-8409
TGTATTGGATATATTTGTAGGTGAAGAGTATAGCCATAACTATGAACCATAGCACTATAA
CCCAACATCTTTGCCAGTTGTCTAACAAGAAGAATCTAAGACCACGGTATGGGATCCTCC
CTATAGTGAG
GenBank Accession CR400943 [GenBank]
Graphic View Graphic view of gene At5g51060
Predicted Position of Insertion Chr5:20760732 - go to primer design
BLAST e Value 4e-55
Hit Clone Code (BAC ID) K3K7
Hit Gene Code At5g51060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NADPH/respiratory burst oxidase protein D
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37