SimpleSearch - Line and FST details


Line specific information

 
Line ID 847B09
Vector Used pAC106
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) 4733, 4756, 4764, 87464, 87481, 87490, 87498, 87506, 87514, 87524, 87529, 87530, 87531, 87532

Gene hit At1g20010

 
Sequence (A. th genome BLAST matches underlined) 
>66-K025837-022-847-B09-8409
CGCGAAGAAGCCATTTACATTGAATATATGTAGGCCAAACGCACGCTCAATTCCAGACAG
GTCCCCGAGAATGAGAGACCCCCTCACGGCTATGTTTAGGCGTAAAGCGTTTCTGCATTA
GTATGGGATCCTCCCTATAGTGAG
GenBank Accession FR816620 [GenBank]
Graphic View Graphic view of gene At1g20010
Predicted Position of Insertion Chr1:6938268 - go to primer design
BLAST e Value 2e-11
Hit Clone Code (BAC ID) T20H2
Hit Gene Code At1g20010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation tubulin beta-5 chain
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit CR401582 [GenBank]


Last Updated on 10.06.2021 13:37