SimpleSearch - Line and FST details


Line specific information

 
Line ID 848B09
Vector Used pAC106
Line Availability available as T3 set from NASC (N481333)
Segregation Analysis 50:39:32
Confirmed for Hit At5g67430
Parent of DUPLO pair none
Parent of pair(s) 3334, 3348

Gene hit At5g67430

 
Sequence (A. th genome BLAST matches underlined) 
>66-K025835-022-848-B09-8409
ATTGAACCGGTCGCACAGCCGAAGAGCTGCGAGTTTGATGATTTTGACTCGTCGAGAGAC
AGTGACTCGGTGGTTGAAGACCGGGTTGACCAAGAAAGTTGGCGTATGGGATCCTCCCTA
TAGTGAG
GenBank Accession CR401675 [GenBank]
Graphic View Graphic view of gene At5g67430
Predicted Position of Insertion Chr5:26911250 - go to primer design
BLAST e Value 3e-34
Hit Clone Code (BAC ID) K8K14
Hit Gene Code At5g67430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Acyl-CoA N-acyltransferases (NAT) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR401675 [GenBank]


Last Updated on 10.06.2021 13:37