SimpleSearch - Line and FST details


Line specific information

 
Line ID 862C12
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) 3162, 8091

Gene hit At1g30620

 
Sequence (A. th genome BLAST matches underlined) 
>91-K025977-022-862-C12-8409
TCTTCATTTAACTTTTCTTTTTCCCCAGATCAAAGGAACAGACTACAAAACCGCTGATGG
AACTTGCGTATGGGATCCTCCCTATAGTGAGACNNANNNNNCNNN
GenBank Accession CR403307 [GenBank]
Graphic View Graphic view of gene At1g30620
Predicted Position of Insertion Chr1:10857444 - go to primer design
BLAST e Value 5e-33
Hit Clone Code (BAC ID) T5I8
Hit Gene Code At1g30620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit CR403306 [GenBank]


Last Updated on 10.06.2021 13:37