SimpleSearch - Line and FST details


Line specific information

 
Line ID 863D07
Vector Used pAC161
Line Availability available as T3 set from NASC (N482795)
Segregation Analysis 50:25:14
Confirmed for Hit At1g12140
Parent of DUPLO pair none
Parent of pair(s) 5315, 5331, 5366, 8648, 10273, 10288, 11337, 91911, 91920, 91932, 91939, 91940, 91941

Gene hit At1g12140

 
Sequence (A. th genome BLAST matches underlined) 
>52-K025978-022-863-D07-8409
ATTGACGTCATCACAGATGGTTCGATTTAAGACCGAAGTAGTTCTTGTCGAGCCTGAAGA
TAAGAAATGGAGGGTTCAATCCAAAAATTCAGATGGGATCTCCAAAGATGAGATCTTTGA
TGCTGTTGTTGTTTGTAATGGACATTATACAGAACCTAGAGTTGCTCATGTTCCTGGTAT
GGGATCCTCCCTATAGTGAG
GenBank Accession CR403447 [GenBank]
Graphic View Graphic view of gene At1g12140
Predicted Position of Insertion Chr1:4121771 - go to primer design
BLAST e Value 2e-88
Hit Clone Code (BAC ID) T28K15
Hit Gene Code At1g12140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation flavin-monooxygenase glucosinolate S-oxygenase 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37