SimpleSearch - Line and FST details


Line specific information

 
Line ID 868B09
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) 5908, 6001, 10455, 10499, 80019, 80102

Gene hit At5g43740

 
Sequence (A. th genome BLAST matches underlined) 
>66-K026080-022-868-B09-8409
ATGNAGCCATTTACAATTGAATATATCATTGATAAGTCATCAACATAAACACAGGAATAA
AAGAATTTCCACACTTGCAGATTTGGTAAGGTTGCTGCTATCCCAACAAGACTCCCACGT
ATGGGATCCTCCCTATAGTGAGACCTATTANTC
GenBank Accession CR404052 [GenBank]
Graphic View Graphic view of gene At5g43740
Predicted Position of Insertion Chr5:17567951 - go to primer design
BLAST e Value 8e-38
Hit Clone Code (BAC ID) MQD19
Hit Gene Code At5g43740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Disease resistance protein (CC-NBS-LRR class) family
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 10.06.2021 13:37