SimpleSearch - Line and FST details


Line specific information

 
Line ID 869G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N483412)
Segregation Analysis 50:37:34
Confirmed for Hit At1g07270
Parent of DUPLO pair 2509
Parent of pair(s) none

Gene hit At1g07270

 
Sequence (A. th genome BLAST matches underlined)
>95-K026082-022-869-G12-8409
TTATTAGCCTGTTAAAAGAGTTTGAATTAAGATAACACTGTCCTTGTTTCAGAAATATTG
TTATGTAATCAAAGCACAACAACCGTATGGGATCCTCCCTATAGTGAGACCTATTCNNGA
NCGGTTGTGCC
GenBank Accession CR404274 [GenBank]
Graphic View Graphic view of gene At1g07270
Predicted Position of Insertion Chr1:2231734 - go to primer design
BLAST e Value 2e-29
Hit Clone Code (BAC ID) F10K1
Hit Gene Code At1g07270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cell division control, Cdc6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37