SimpleSearch - Line and FST details


Line specific information

 
Line ID 871D07
Vector Used pAC161
Line Availability available as T3 set from NASC (N483563)
Segregation Analysis 50:12:7
Confirmed for Hit At2g30890
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g30890

 
Sequence (A. th genome BLAST matches underlined) 
>52-K026083-022-871-D07-8409
AGCCTTTACATTGTTAATCACAAGTATCACTGCAACCATCTGCTTCATAAATTAATCACA
TTGTTAATTGCTCACTTAATATTCCAAGTAAACTATGAGCCGCTTGTTGATAGATAACAA
TAGTTAAAAGTATGGGATCCTCCCTATAGTGAGACNNATTANTCNNNNNNN
GenBank Accession CR404463 [GenBank]
Graphic View Graphic view of gene At2g30890
Predicted Position of Insertion Chr2:13148977 - go to primer design
BLAST e Value 1e-58
Hit Clone Code (BAC ID) F7F1
Hit Gene Code At2g30890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cytochrome b561/ferric reductase transmembrane protein family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37