SimpleSearch - Line and FST details


Line specific information

 
Line ID 875C10
Vector Used pAC161
Line Availability available as T3 set from NASC (N483938)
Segregation Analysis 50:34:28
Confirmed for Hit At4g21100
Parent of DUPLO pair 9501
Parent of pair(s) none

Gene hit At4g21100

 
Sequence (A. th genome BLAST matches underlined)
>75-K026467-022-875-C10-8409
CGGTGGATATGTTGAAGCAATTATCAGTATGGGATCCTCCCTATAGTGAGACCTATTACT
CCCCCCCT
GenBank Accession FR816946 [GenBank]
Graphic View Graphic view of gene At4g21100
Predicted Position of Insertion Chr4:11259377 - go to primer design
BLAST e Value 6e-05
Hit Clone Code (BAC ID) F7J7
Hit Gene Code At4g21100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation damaged DNA binding protein 1B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37