SimpleSearch - Line and FST details


Line specific information

 
Line ID 901E08
Vector Used pAC161
Line Availability available as T3 set from NASC (N486456)
Segregation Analysis 60:60:20
Confirmed for Hit At3g16640
Parent of DUPLO pair none
Parent of pair(s) 9577

Gene hit At3g16640

 
Sequence (A. th genome BLAST matches underlined) 
>61-K029994-022-901-E08-8409
ATTTACAATTGATCCATGTCCGGACATCATACTCTTTCTTTTTCCACTTCATTGCTTACC
GGTGAGAAGATCTTGGTATGGGATCCTCCCTATAGTGAGACGTATTACTCCCCCCCTTTT
AGACCCCCCCCTTCGGACATCCCTGTTCCCCTCCCTCTTTTGAAATCTATCTTCCCCTTT
TTTTTTTTCCTTTTTTGGTGGGGGGGGGGGGGGGCCTCTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTGTTTTTTTATTTTTTTTTTTTTTGTTT
GenBank Accession CR935866 [GenBank]
Graphic View Graphic view of gene At3g16640
Predicted Position of Insertion Chr3:5670671 - go to primer design
BLAST e Value 6e-05
Hit Clone Code (BAC ID) MGL6
Hit Gene Code At3g16640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation translationally controlled tumor protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR935866 [GenBank]


Last Updated on 10.06.2021 13:37