SimpleSearch - Line and FST details


Line specific information

 
Line ID 907G01
Vector Used pAC161
Line Availability available as T3 set from NASC (N487049)
Segregation Analysis 50:50:48
Confirmed for Hit At1g49820
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g49820

 
Sequence (A. th genome BLAST matches underlined) 
>07-K030572-022-907-G01-8409
ATTCCTTAATTTCGGTTTAATCGAAACCAAAGAAACCCACCTAATATTGATTCAGTTTAG
TTCAGGTTTTCTGGTTAAGAACTTAATTTTTTTTTCCCCTTTTAAATAACTTGCCTTATT
TGAGTTTAAATCCATATGATAGGCTTTTGGTATGGGATCCTCCCTATAGTGAGTCGTATT
ACTCACTCCCTTTTA
GenBank Accession CT572960 [GenBank]
Graphic View Graphic view of gene At1g49820
Predicted Position of Insertion Chr1:18442879 - go to primer design
BLAST e Value 3e-62
Hit Clone Code (BAC ID) F10F5
Hit Gene Code At1g49820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-methyl-5-thioribose kinase
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT572959 [GenBank]


Last Updated on 10.06.2021 13:37