SimpleSearch - Line and FST details


Line specific information

 
Line ID 907G04
Vector Used pAC161
Line Availability available as T3 set from NASC (N487052)
Segregation Analysis 50:50:38
Confirmed for Hit At5g07620
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g07620

 
Sequence (A. th genome BLAST matches underlined) 
>31-K030571-022-907-G04-8409
TCGGGAATGAGCCATTTATTCAGTGTTTCATTATTTGTCTTAAATATTATTTTCTTCACC
TTTTACAAAATATAAGGTATGAGATCATCTTTGTCTTTTGCTCTGTATGGGATCCTCCCT
ATAGTGAGTCGTATTACTCACGGCCTTTG
GenBank Accession CT572963 [GenBank]
Graphic View Graphic view of gene At5g07620
Predicted Position of Insertion Chr5:2408201 - go to primer design
BLAST e Value 5e-30
Hit Clone Code (BAC ID) MBK20
Hit Gene Code At5g07620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT572964 [GenBank]


Last Updated on 10.06.2021 13:37