SimpleSearch - Line and FST details


Line specific information

 
Line ID 934B09
Vector Used pAC161
Line Availability available as T3 set from NASC (N489589)
Segregation Analysis 50:44:31
Confirmed for Hit At1g07940
Parent of DUPLO pair none
Parent of pair(s) 36952, 81661, 81662
Note

Gene hit At1g07920

 
Sequence (A. th genome BLAST matches underlined)
>66-K031923-022-934-B09-8409
AATTGAATACCACCAATCTTGTAGACATCCTGAAGTGGGAGACGAAGGGGCTTGTCTGAC
GGCCTCTTGGGCTCGTTGATCTGGTCAAGAGCCTCAAGGAGAGTTGGTCCCTTGTATGGG
ATCCTCCCTATAGTGAGACNNATTANNC
GenBank Accession CT955110 [GenBank]
Graphic View Graphic view of gene At1g07920
Predicted Position of Insertion Chr1:2456392 - go to primer design
BLAST e Value 6e-56
Hit Clone Code (BAC ID) T6D22
Hit Gene Code At1g07920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GTP binding Elongation factor Tu family protein
Insertion Classification CDSi
Confirmation Status failed

Gene hit At1g07940

 
Sequence (A. th genome BLAST matches underlined)
>66-K031923-022-934-B09-8409
AATTGAATACCACCAATCTTGTAGACATCCTGAAGTGGGAGACGAAGGGGCTTGTCTGAC
GGCCTCTTGGGCTCGTTGATCTGGTCAAGAGCCTCAAGGAGAGTTGGTCCCTTGTATGGG
ATCCTCCCTATAGTGAGACNNATTANNC
GenBank Accession CT955110 [GenBank]
Graphic View Graphic view of gene At1g07940
Predicted Position of Insertion Chr1:2463959 - go to primer design
BLAST e Value 6e-56
Hit Clone Code (BAC ID) T6D22
Hit Gene Code At1g07940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GTP binding Elongation factor Tu family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37