SimpleSearch - Line and FST details


Line specific information

 
Line ID 947B12
Vector Used pAC161
Line Availability available as T3 set from NASC (N490840)
Segregation Analysis 50:27:18
Confirmed for Hit At4g18905
Parent of DUPLO pair none
Parent of pair(s) 94049, 94050

Gene hit At4g18905

 
Sequence (A. th genome BLAST matches underlined) 
>90-K032909-022-947-B12-8409
TTCTTGCCTTGCTATTGGTGGCGCAAAGGGAGAGCTCCATGCTGAGTGGAAATTANATAA
TAATCATGTAGTTAAAACATATCATTTTATTAGGTATGGGATCCTCCCTATAGTGAGTCC
TATTACTCACTCCCCTTTCNTTCCCCCCC
GenBank Accession CT955597 [GenBank]
Graphic View Graphic view of gene At4g18905
Predicted Position of Insertion Chr4:10362813 - go to primer design
BLAST e Value 9e-32
Hit Clone Code (BAC ID) F13C5
Hit Gene Code At4g18905 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT955597 [GenBank]


Last Updated on 10.06.2021 13:37