SimpleSearch - Line and FST details
Line specific information
| Line ID | 952C07 |
| Vector Used | pAC161 |
| Line Availability | not available |
| Segregation Analysis | unknown |
| Parent of DUPLO pair | 8992 |
| Parent of pair(s) | none |
| Note |
Gene hit At1g72280
| Sequence (A. th genome BLAST matches underlined) | >51-K112403w-0022-952-C07-8409 TGGCGATGGCCTTTCCGACTTTGGTTGTCGTGTTTTTGGCCGTTGCTGTGAGCTCTCACC TGCCGGGCC |
| GenBank Accession | FR818587 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr1:27214455 - go to primer design |
| BLAST e Value | 4e-14 |
| Hit Clone Code (BAC ID) | T9N14 |
| Hit Gene Code | At1g72280 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | endoplasmic reticulum oxidoreductins 1 |
| Insertion Classification | CDSi |
| Confirmation Status | failed |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
