GABI-Kat confirmation strategy

The figure applies to the confirmation of FSTs that were created at the left border (LB) with the primer o8409. In case of right border (RB) FSTs, o3144/35St is used instead of o8474 and o8409 in both the confirmation PCR and amplicon sequencing. The result obtained from sequencing the confirmation amplicon is compared to the FST prediction, and if the two sequences match the insertion allele is considered "confirmed", and the respective line is delivered.
| Primer name | Sequence (5' to 3') |
|---|---|
| o3144/35St | GTGGATTGATGTGATATCTCC |
| o8409 | ATATTGACCATCATACTCATTGC |
| o8474 | ATAATAACGCTGCGGACATCTACATTTT |
| 94 °C | 2 min | |
| 94 °C | 30 sec | |
| 59 °C | 30 sec | 37 cycles |
| 72 °C | 90 sec | |
| 72 °C | 5 min | |
| 15 °C | for ever |



gabi-kat.de 
