SimpleSearch - Line and FST details


Line specific information

 
Line ID 019A12
Vector Used pAC106
Line Availability available as T3 set from NASC (N401740)
Segregation Analysis 50:43:37
Confirmed for Hit At3g62260
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g62260

 
Sequence (A. th genome BLAST matches underlined) 
>71-K017011-022-019-A12T-8409
GATCTGTAGATTCCNGGACATGAGCCATTTACAATTGATATATCCTGCGCATAAACACAA
GATCTGACAGAGCGGTGGTACCACAAGATCGCTGATACTGCAATCCTCTGCCAAAGCTAT
GGGATCTCNCCTATAGTGAG
GenBank Accession AL936105 [GenBank]
Graphic View Graphic view of gene At3g62260
Predicted Position of Insertion Chr3:23039359 - go to primer design
BLAST e Value 1e-16
Hit Clone Code (BAC ID) T17J13
Hit Gene Code At3g62260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein phosphatase 2C family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

 
Line 019A12 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37