SimpleSearch - Line and FST details


Line specific information

 
Line ID 054C05
Vector Used pAC161
Line Availability available as T3 set from NASC (N405117)
Segregation Analysis 50:47:42
Confirmed for Hit At1g08820
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g08820

 
Sequence (A. th genome BLAST matches underlined)
>35-K012480-022-054-C05-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGATAGT
TTAAATGGCTTCATGTCCGGAAATACGGTTAAGGATGCGGATGATGGAAGGGCGATTAAG
GCAACAACTAATTTGGACGCTCCCATGAAGAAGGCCATGGATCTACCTATGGGATCCTCC
CTATAGTGANNNNNNNNNNNNNNNNNNN
GenBank Accession AL754404 [GenBank]
Graphic View Graphic view of gene At1g08820
Predicted Position of Insertion Chr1:2822466 - go to primer design
BLAST e Value 2e-37
Hit Clone Code (BAC ID) F22O13
Hit Gene Code At1g08820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation vamp/synaptobrevin-associated protein 27-2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL754404 [GenBank]

 
Line 054C05 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37