SimpleSearch - Line and FST details


Line specific information

 
Line ID 088G05
Vector Used pAC161
Line Availability available as T3 set from NASC (N408429)
Segregation Analysis 50:49:39
Confirmed for Hit At5g10340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g10340

 
Sequence (A. th genome BLAST matches underlined)
>39-K016185-022-088-G05-8409
CGTGTCATGGCATGGGCTGACATGGATTCTNCTATAGCATCTTGCTTATAGTGAGANCGA
CTTGCGCACGAAATACCGAGATGTCCCCATGGGCGACACTCACACCTCGCTCACACTCAG
GACAGCCTATGGGATCCTCCCTATAGTGAGANNGCNCGCCCNNTCCCCCTATGGGATCCT
CCCTATAGTGAG
GenBank Accession AL937727 [GenBank]
Graphic View Graphic view of gene At5g10340
Predicted Position of Insertion Chr5:3253202 - go to primer design
BLAST e Value 1e-28
Hit Clone Code (BAC ID) F12B17
Hit Gene Code At5g10340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

 
Line 088G05 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37