SimpleSearch - Line and FST details


Line specific information

 
Line ID 283D09
Vector Used pAC161
Line Availability available as T3 set from NASC (N427117)
Segregation Analysis 50:50:42
Confirmed for Hit At4g28520 At1g63370
Parent of DUPLO pair none
Parent of pair(s) 1658, 3397, 91874, 91882, 91891, 91898, 91908, 91918, 91919, 91920, 91921, 91922, 91923, 91924, 91925, 91926

Gene hit At1g63370

 
Sequence (A. th genome BLAST matches underlined)
>68-K015178-022-283-D09-8409
TTGTCCATGTAGATTTCCCGGACTGAAGCACTTTACAATTGTATATTCTAGTTACACGCA
TCCCCTGAACACCTTAGAGATAGGTACTTATTTTATTGATCTAATGTTTAATTCTCTTGC
ATAATTGGATTGTGCTGGCAACGATTATGTTGCTGTGCTTATTGGGAACTCTTCAAGTGC
TGAGGATATAAGTAGGGACATTGCTATGGGATCCTCCCATTAGTGAG
GenBank Accession AL944605 [GenBank]
Graphic View Graphic view of gene At1g63370
Predicted Position of Insertion Chr1:23504349 - go to primer design
BLAST e Value 7e-49
Hit Clone Code (BAC ID) F9N12
Hit Gene Code At1g63370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Flavin-binding monooxygenase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

 
Line 283D09 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37