SimpleSearch - Line and FST details


Line specific information

 
Line ID 003C10
Vector Used pAC106
Line Availability available as T3 set from NASC (N400226)
Segregation Analysis 50:21:9
Confirmed for Hit At1g59890
Parent of DUPLO pair 12158
Parent of pair(s) none

Gene hit At1g59890

 
Sequence (A. th genome BLAST matches underlined) 
>81-011449-rosso-C10-oriL
TAATCGAAAAACTGTCCTACCTAACTGAGATCTGATACCTTAGGTTCATGGAAGCCCTTT
ACATTCTACTCGATGGCCTCTAGGGAAGCAACCCCCCCCCGGGGGTAAAAAATGGATACC
CCCCCTTTTTNACCCACCCAAAAACACCCCACCCGGGACCCCAAAGAAATTTCCTCTTTT
GGAAAAAAGGGGGGAAACCCAAACAAAAAAAGCGCCCCCCAGGGGCCCCCCCCCGNCACC
ACCGGAGAAGAAAGGAGCCC
GenBank Accession FR799811 [GenBank]
Graphic View Graphic view of gene At1g59890
Predicted Position of Insertion Chr1:22049491 - go to primer design
BLAST e Value 9e-08
Hit Clone Code (BAC ID) F23H11
Hit Gene Code At1g59890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SIN3-like 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37