SimpleSearch - Line and FST details


Line specific information

 
Line ID 009C11
Vector Used pAC106
Line Availability available as T3 set from NASC (N400803)
Segregation Analysis 50:5:3
Confirmed for Hit At3g28360
Parent of DUPLO pair none
Parent of pair(s) 10608, 10624, 84126, 84140, 84153, 84165, 84179, 84189, 84190, 84193, 84194, 84196, 84197, 84198, 84199

Gene hit At3g28360

 
Sequence (A. th genome BLAST matches underlined) 
>83-K028791-022-009-C11-8409
ATCGCTGATGGGAATATGGTATCANNANCATTCTTTGAGTTATTTTTGATCTTTAAAACT
ACNGGCCGGGCTATTGCCGAAGCTGGAACAATGACAACNGATCTAGCCAAGGGCTCGGAT
TGCGGTGACTCAATATTCACAGTGTTATATCAACTAACCACCATTGAACAGGAGAATTCC
GATGAATAATCAGAGAAGAGATAAAGGAGCATATCATATATATCAAAGAGA
GenBank Accession CR933963 [GenBank]
Graphic View Graphic view of gene At3g28360
Predicted Position of Insertion Chr3:10612107 - go to primer design
BLAST e Value 2e-48
Hit Clone Code (BAC ID) MFJ20
Hit Gene Code At3g28360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-glycoprotein 16
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR933963 [GenBank]


Last Updated on 10.06.2021 13:37