SimpleSearch - Line and FST details


Line specific information

 
Line ID 010G06
Vector Used pAC106
Line Availability available as T3 set from NASC (N400942)
Segregation Analysis 50:44:42
Confirmed for Hit At2g16370
Parent of DUPLO pair none
Parent of pair(s) 69523, 97580

Gene hit At2g16370

 
Sequence (A. th genome BLAST matches underlined) 
>47-K014861-022-010-G06-8409
TTGCTATTACATACCACCCTATGGGAACTACCGATCATTTGGTTTATTAAAAAATACGAG
TGAATCCAATGATAGGCCCTCTATGAATGGACTCATATTACCCTATTGTGGGTGATAACT
TGGCATAAACATTGATTGGAATCCCCAATGGG
GenBank Accession AL752058 [GenBank]
Graphic View Graphic view of gene At2g16370
Predicted Position of Insertion Chr2:7082142 - go to primer design
BLAST e Value 2e-12
Hit Clone Code (BAC ID) F16F14
Hit Gene Code At2g16370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation thymidylate synthase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL935949 [GenBank] AL935949 [GenBank] AL752058 [GenBank]


Last Updated on 10.06.2021 13:37